|
TaKaRa
crispr cas9 plasmid map Crispr Cas9 Plasmid Map, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide/pm42086878-441-1-14?v=TaKaRa Average 95 stars, based on 1 article reviews
crispr cas9 plasmid map - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
Benchling Inc
crispr guide rna design tool Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide/pmc13155868-62-34-40?v=Benchling+Inc Average 86 stars, based on 1 article reviews
crispr guide rna design tool - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Nature Biotechnology
rna guided crispr cas9 Rna Guided Crispr Cas9, supplied by Nature Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide/us12655421-635-24-58?v=Nature+Biotechnology Average 86 stars, based on 1 article reviews
rna guided crispr cas9 - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Benchling Inc
crispr guide rna design tools benchling Crispr Guide Rna Design Tools Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide/pm42277432-365-25-30?v=Benchling+Inc Average 86 stars, based on 1 article reviews
crispr guide rna design tools benchling - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
design optimization crispr cas spcas9 guide rna ggacagaaugaugaaccugg editing Design Optimization Crispr Cas Spcas9 Guide Rna Ggacagaaugaugaaccugg Editing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide/pm42269214-46-7-18?v=Synthego+Inc Average 86 stars, based on 1 article reviews
design optimization crispr cas spcas9 guide rna ggacagaaugaugaaccugg editing - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Nature Biotechnology
ψdna guided crispr cas12a system ψdna Guided Crispr Cas12a System, supplied by Nature Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide/pm42141118-269-10-0?v=Nature+Biotechnology Average 86 stars, based on 1 article reviews
ψdna guided crispr cas12a system - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
10X Genomics
cg000510 chromium nextgem single cell 5 v2 crispr user guide Cg000510 Chromium Nextgem Single Cell 5 V2 Crispr User Guide, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide/pm42119563-425-10-22?v=10X+Genomics Average 86 stars, based on 1 article reviews
cg000510 chromium nextgem single cell 5 v2 crispr user guide - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Benchling Inc
crispr guide sequence Crispr Guide Sequence, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide/pm42098104-245-1-6?v=Benchling+Inc Average 86 stars, based on 1 article reviews
crispr guide sequence - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Benchling Inc
crispr guide rnas grnas Crispr Guide Rnas Grnas, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide/pm42076768-71-0-19?v=Benchling+Inc Average 86 stars, based on 1 article reviews
crispr guide rnas grnas - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |